Номер части:
ISSN: 2411-6467 (Print)
ISSN: 2413-9335 (Online)
Статьи, опубликованные в журнале, представляется читателям на условиях свободной лицензии CC BY-ND


Науки и перечень статей вошедших в журнал:
Дата публикации статьи в журнале:
Название журнала: Евразийский Союз Ученых, Выпуск: , Том: , Страницы в выпуске: -


В Монголии отмечены более 14 тысяч видов насекомых, относящихся к 847 родам. В нашей стране распространены повсеместно более 1300 видов насекомых-вредителей леса, пастбищ, сельскохозяйственных угодий. В борьбе против насекомых-вредителей используют химические методы борьбы, которые приводят к появлению новых видов насекомых, устойчивых к их действию [2, с.15]. Поэтому перед учеными ставится задача изыскания местных штаммов бактерий, которых можно использовать как основу для биопрепарата против насекомых-вредителей.

Методы исследования

Из лесных биоценозов с помощью метода ударения нами собраны из стволов деревьев погибшие гусеницы насекомых, гусеницы с признаками заболевания [2, с.32]

Выделение ДНХ: Из колоний 12-часовых культур, выросших на твердой агаризованной  питательной среде, отбирали 2-3 образца с помощью бактериальной петли, переносили в 200 мл стерильной воды. Данную суспензию охлаждали до -70оС в течение 20 минут, после чего кипятили 10 минут. Охладив до комнатной температуры, центрифугировали при 10000 оборот/мин. Из этого супернатанта мы использовали 100 мл. Условия проведения ПЦР: Начало при 95оС в течение 2 минут, 30 циклов. Этап денатурации при 95оС в течение 1 минуты. Этап связывания с праймером — 48оС в течение 1 минуты. Этап удлинения — 72оС в течение 1 минуты. Этап увеличения  при 72оС в течение 5 минут. Охлаждение при 4оС. После этого проводим гелевый электрофорез [1, 38, с.3826]

Результаты исследования

Все выделенные штаммы не обладают уреазной активностью, образуют АМК, обладают протеолитической активностью, образуют осадок, кроме штамма N2 и положительного контроля все другие штаммы образуют пленку. Высокой лецитиназной активностью обладают штамм N2 и положительный контроль. Самой малой лецитиназной активностью обладает штамм М17 (таблица 1)

Таблица  1

Некоторые физиолого-биохимические признаки выделенных местных штаммов кристаллообразующих бактерий




АМК Лецитиназная активность Уреазная активность Гидролиз крахмала Протеолит. активность Образование


1 N1 + ++ + + + +
2 N2 + +++ + + +
3 M16 + ++ + + + +
4 M17 + + + + + +
5 Контроль /+/ + +++ + + +
6 Контроль /-/

Пояснение: (+++)- высокая активность, ++ — средняя, + — малая, (-)-отсутствует

Таблица 2

Разложение углеводов


Название углевода

Сахароза Глюкоза Мальтоза Манноза Сорбит лактоза фруктоза
1 N1 + + + + +
2 N2 + + + +
3 M16 +- + + + + +
4 M17 + + + +
5 Контроль + + + + +
6 Контроль —

Пояснение: (+) – разлагает, (-)  — не разлагает, (+-) – слабо разлагает

Выделенные штаммы кристаллообразующих бактерий по физиолого-биохимическим признакам соотвествуют виду Bac.thuringiensis. Для подтверждения видовой принадлежности мы провели цепную полимеразную реакцию восьми штаммов. Мы использовали праймеры CJI-1 (3’TGTAGAAGAGGAAGTCTATCCA5’),CJI2(3’TATCGGTTTCTGGGAAGTA5’), кодирующие ген Cry1. В ходе этой реакции мы установили наличие данного гена в штаммах М17, М16, N1, N2. Положительным контролем служил продуцент китайского биопрепарата Bacillus thuringiensis var.kurstaky, выделенный из этого препарата в чистом виде.


Рисунок 1. Результат ЦПР

В лабораторных и полевых условиях нами проведены исследования по биологической активности выделенных штаммов на гусеницах непарного шелкопряда. Результаты представлены на рисунках 2, 3.


Рисунок 2.  Гибель гусениц непарного шелкопряда (Lymantria dispar)

в лабораторных условиях


Рисунок 3. Гибель гусениц непарного шелкопряда (Lymantria dispar)

в полевых условиях

В лабораторных условиях при подсчёте гибели гусениц непарного шелкопряда,  проведенного с помощью формулы Абботы, установили, что Лепидоцид вызывает 100%-ную гибель насекомых при расходе 3.5 л/га на 4 сутки, тогда как выделенные нами местные штаммы N1 /100%/, М16 /75%/, М17 /60%/ вызывают гибель гусениц на 5 сутки.


  1. Из выделенных местных штаммов кристаллообразующих бактерий 4 штамма и культура биопрепарата Лепидоцид не обладают уреазной активностью, гидролизуют крахмал, обладают протеолитической активностью, образуют осадок, штаммы М16, М17, N1 гидролизуют простые сахара.
  2. При анализе ПЦР нами установлено наличие гена Cry1, отвественного за продуцирование кристалла-токсина.
  3. При проведении исследований по биологической активности выделенных штаммов установлена гибель гусениц от местных штаммов 60%-100% на пятые сутки, тогда как от биопрепарата гибель наступает на четвертые сутки. При повторном анализе ЦПР штаммов бактерий, выделенных из погибших гусениц, нами доказано, что гибель гусениц произошла от штаммов кристаллообразующих бактерий.

Список литературы:

  1. www.BGSC.org/catalogs.php
  2. Дэлгэрмаа С., 2000 г “Эколого-биологическая роль энтомопатогенных бактерий, выделенных из биоценозов Монголий, их трофические потребности” — Дисс. на соиск.уч.степ. к.б.н, 2000, ИГУ, г.Иркутск
  3. JAIRO CERO´ N, ANABEL ORTI´Z, RODOLFO QUINTERO, LEOPOLDO GU¨ERECA, ALEJANDRA BRAVO, Nov. 1995, Specific PCR Primers Directed To Identify Сry I and Сry III Genes within a Bacillus thuringiensis Strain Collect. 3826–3831 Vol. 61, No. 11, American Society for Microbiology[schema type=»book» name=»МИКРОБИОЛОГИЧЕСКОЕ ИССЛЕДОВАНИЕ ЭНТОМОПАТОГЕННЫХ БАКТЕРИЙ ВИДА BAC.THURINGIENSIS, ВЫДЕЛЕННЫХ ИЗ БИОЦЕНОЗОВ МОНГОЛИИ» description=»Цель – выделение местных штаммов кристаллообразующих бактерий из насекомых-вредителей, собранных из лесных биоценозов Монголии. Метод исследования: Использованы традиционные микробиологические методы и метод цепной полимеразной реакции [1]. Результат исследования: Из выделенных местных штаммов отобраны 8 штаммов, различных по морфологическим признакам, проведен анализ ЦПР. На основе результатов ЦПР готовили суспензии, которыми были заражены гусеницы непарного шелкопряда. Вывод: Из местных штаммов кристаллообразующих бацилл вида Bacillus thuringiensis в четырех штаммах нами обнаружен ген Cry1, отвественный за продуцирование эндотоксина. Гибель гусениц составил 100%, что доказывает высокую биологическую активность данных штаммов.» author=»Совд Дэлгэрмаа, Совд Дэлгэрмаа» publisher=»БАСАРАНОВИЧ ЕКАТЕРИНА» pubdate=»2017-01-09″ edition=»euroasia-science.ru_29-30.12.2015_12(21)» ebook=»yes» ]
Список литературы:

Записи созданы 9819

Похожие записи

Начните вводить, то что вы ищите выше и нажмите кнопку Enter для поиска. Нажмите кнопку ESC для отмены.

Вернуться наверх